wnt7bb

Ensembl ID:
ENSDARG00000071107
ZFIN ID:
ZDB-GENE-081006-1
Description:
Protein Wnt [Source:UniProtKB/TrEMBL;Acc:B6VA40]
Human Orthologue:
WNT7B
Human Description:
wingless-type MMTV integration site family, member 7B [Source:HGNC Symbol;Acc:12787]
Mouse Orthologue:
Wnt7b
Mouse Description:
wingless-related MMTV integration site 7B Gene [Source:MGI Symbol;Acc:MGI:98962]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32508 Nonsense Available for shipment Available now
sa24585 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104915 Nonsense 155 352 3 4
Genomic Location (Zv9):
Chromosome 25 (position 1960249)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1928420
GRCz11 25 2019656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGGAAAAACAGGGCTACTACAACCAGGAGGAGGGCTGGAAATGGGGC[G/T]GATGTTCTGCTGATATTAAATACGGCATCGAGTTCTCACGGAAGTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104915 Nonsense 177 352 3 4
Genomic Location (Zv9):
Chromosome 25 (position 1960183)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 1928354
GRCz11 25 2019590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATACGGCATCGAGTTCTCACGGAAGTTTGTGGATGCTCGGGAGATT[A/T]AAAAAAATGCCAGACGGCTGATGAACCTACATAACAATGAAGCCGGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link