si:dkey-222p3.1

Ensembl ID:
ENSDARG00000071103
ZFIN ID:
ZDB-GENE-050208-374
Description:
hypothetical protein LOC100007529 [Source:RefSeq peptide;Acc:NP_001091736]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18115 Essential Splice Site Available for shipment Available now
sa15714 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104912 Essential Splice Site 18 163 2 4
ENSDART00000147686 Essential Splice Site 46 191 2 4
Genomic Location (Zv9):
Chromosome 22 (position 30447187)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28263381
GRCz11 22 28213502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGCAGTGGGTTTCTGATCTGTTTCTTGATATCACTCTCAAGTGAAGG[T/G]AAGGATGTACAGTTTATCWAAGACAAGATRCTGCAGGCAAATAGGGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104912 Essential Splice Site 18 163 3 4
ENSDART00000147686 Essential Splice Site 46 191 3 4
Genomic Location (Zv9):
Chromosome 22 (position 30450396)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28260172
GRCz11 22 28210293
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAACTTCATCTYTYACATATTTCTGGCCTTAACTTCCTTTTGTTTTC[A/C]GCATCTGTGCAGAAAACATTTGAGGGTTTCATCGGAGGTTCTGCACTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link