zgc:55418

Ensembl ID:
ENSDARG00000071095
ZFIN IDs:
ZDB-GENE-030131-6041, ZDB-GENE-030131-6041, ZDB-GENE-030131-6041
Description:
hypothetical protein LOC100149890 [Source:RefSeq peptide;Acc:NP_956153]
Human Orthologue:
ABI3BP
Human Description:
ABI family, member 3 (NESH) binding protein [Source:HGNC Symbol;Acc:17265]
Mouse Orthologue:
Abi3bp
Mouse Description:
ABI gene family, member 3 (NESH) binding protein Gene [Source:MGI Symbol;Acc:MGI:2444583]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17654 Essential Splice Site Available for shipment Available now
sa37542 Nonsense Mutation detected in F1 DNA During 2018
sa1628 Essential Splice Site Available for shipment Available now
sa37541 Nonsense Mutation detected in F1 DNA During 2018
sa37540 Nonsense Mutation detected in F1 DNA During 2018
sa32407 Essential Splice Site Available for shipment Available now
sa43868 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030404 Essential Splice Site None 157 2 19
ENSDART00000089546 Essential Splice Site 31 785 2 21
ENSDART00000128016 Essential Splice Site 31 807 2 22
Genomic Location (Zv9):
Chromosome 22 (position 30122122)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28504896
GRCz11 22 28455017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACTGGTTCATGAGCCAGTAATTCACATTTTGTTTTCCNTTTTTTGCA[G/A]TAAGAAGACAAAATRTGAAGGTTCGCATCAATGCCACYGGAGATACAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030404   None 157 4 19
ENSDART00000089546 Nonsense 136 785 4 21
ENSDART00000128016 Nonsense 136 807 4 22
Genomic Location (Zv9):
Chromosome 22 (position 30116506)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28510512
GRCz11 22 28460633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACCTCTTCACCTGGTGATTGATTCTGTCACACCAACATCTGTGCTTT[T/A]ATCCTGGGGAACCTACTTAAAGACACCCTATGAGGGAAACATCATGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030404 Essential Splice Site 8 157 4 19
ENSDART00000089546 Essential Splice Site 158 785 4 21
ENSDART00000128016 Essential Splice Site 158 807 4 22
Genomic Location (Zv9):
Chromosome 22 (position 30116438)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28510580
GRCz11 22 28460701
KASP Assay ID:
554-1569.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAGACACCCTATGAGGGAAACATCATGAACGACTGCTTGGAGGAAGGG[T/G]GAGTTACACACACAACATCTGGATTTTACTTTTTCCTCCACCAACATGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030404 Nonsense 21 157 5 19
ENSDART00000089546 Nonsense 171 785 5 21
ENSDART00000128016 Nonsense 171 807 5 22
Genomic Location (Zv9):
Chromosome 22 (position 30115668)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28511350
GRCz11 22 28461471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAACCAGGCACTACACCATACGCTACAGAGAAAGAAACAGGAAGTG[G/A]ATCTACCAGACCTGCTCCACCTCTGATACCGTGATTGACAACCTCAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030404   None 157 None 19
ENSDART00000089546   None 785 None 21
ENSDART00000128016 Nonsense 432 807 12 22
Genomic Location (Zv9):
Chromosome 22 (position 30107695)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28519323
GRCz11 22 28469444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCCCCCAACAGCAAACGGTGAGCACCATAAAGGACTTTCTTTCCCC[A/T]AACCAGCCATCTGGTCCAGAGCAAGAATGGGTAAACAGAGCCAACTCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030404 Essential Splice Site None 157 13 19
ENSDART00000089546 Essential Splice Site 581 785 15 21
ENSDART00000128016 Essential Splice Site 603 807 16 22
Genomic Location (Zv9):
Chromosome 22 (position 30102124)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28524894
GRCz11 22 28475015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTCCTTCATTATTCTCGACTGGGAGAAAACAGATAATGAGACAACAG[G/A]TAGGAAATTCATTATTTAATATCAGTAGACCGGGTGACGCAGTGGCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030404 Essential Splice Site None 157 None 19
ENSDART00000089546 Essential Splice Site 748 785 None 21
ENSDART00000128016 Essential Splice Site 770 807 None 22
Genomic Location (Zv9):
Chromosome 22 (position 30095625)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28531393
GRCz11 22 28481514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGAATGTTTACTTGGGTTAGAGTCTAATTCTTTTCTTGATCATTTTC[A/C]GGCTTCTATCGGGCCATGAGACAAGAGCCAGTTCATTTCGGCCAGATAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link