
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
chrm3a
- Ensembl ID:
- ENSDARG00000071091
- ZFIN ID:
- ZDB-GENE-090410-4
- Description:
- Muscarinic cholinergic receptor 3 [Source:UniProtKB/TrEMBL;Acc:Q2LGG2]
- Human Orthologue:
- CHRM3
- Human Description:
- cholinergic receptor, muscarinic 3 [Source:HGNC Symbol;Acc:1952]
- Mouse Orthologue:
- Chrm3
- Mouse Description:
- cholinergic receptor, muscarinic 3, cardiac Gene [Source:MGI Symbol;Acc:MGI:88398]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42905 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42905
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104893 | Nonsense | 53 | 595 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 17 (position 19664577)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 19814588 GRCz11 17 19834424 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGTCAACCTCACTGCTGTTTTCAAGCTCAATGGGAGTAATGCTGAGGCT[G/T]AAGGTCAATCCTATGATCCTCTGGGTGGACACTCGCTCTGGCAGGTCATT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)
- Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)
- Thiazide-induced adverse metabolic effects in hypertensive patients: Genome-wide association analyses suggest NELL1 influences adverse metabolic response to HCTZ in African Americans. (View Study)
- Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: