slc35b4

Ensembl ID:
ENSDARG00000071087
ZFIN ID:
ZDB-GENE-030131-2457
Description:
UDP-xylose and UDP-N-acetylglucosamine transporter [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW46]
Human Orthologue:
SLC35B4
Human Description:
solute carrier family 35, member B4 [Source:HGNC Symbol;Acc:20584]
Mouse Orthologue:
Slc35b4
Mouse Description:
solute carrier family 35, member B4 Gene [Source:MGI Symbol;Acc:MGI:1931249]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44216 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11628 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104888 Essential Splice Site 142 331 5 10
Genomic Location (Zv9):
Chromosome 25 (position 3407261)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3225456
GRCz11 25 3351200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGTCTGTTGGCATTTTCATCTGCACGATAATGTCTGCAAAACAAGTG[G/A]TGAGTTTTTCAGTCACTTCAGTCTCGAAATACGATATTTGTTGTTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104888 Nonsense 155 331 6 10
Genomic Location (Zv9):
Chromosome 25 (position 3407411)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3225606
GRCz11 25 3351350
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTTATGCAGAATGTTGAGAAAGGCGGCACAGAGGAGGATGGAGTTTA[T/A]GCCTTCATGCATTGGCTTCTGGGTAATATTTCCATTACACTTTAACACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link