
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-162i18.2
- Ensembl ID:
- ENSDARG00000071085
- ZFIN ID:
- ZDB-GENE-060503-46
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L865]
- Human Orthologue:
- GPR128
- Human Description:
- G protein-coupled receptor 128 [Source:HGNC Symbol;Acc:19241]
- Mouse Orthologue:
- Gpr128
- Mouse Description:
- G protein-coupled receptor 128 Gene [Source:MGI Symbol;Acc:MGI:2441732]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37538 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa16563 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37538
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104886 | Essential Splice Site | 92 | 345 | 2 | 7 |
ENSDART00000145595 | None | 160 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 29961787)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 28665240 GRCz11 22 28615361 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTATCCATTGTGGGCTTGGTCCTTACAACAATGTATCAAATTAAAACAAG[G/A]TACGTTCAAAAAAAGAACATGAATACATTTTAAATATATATGAGCATTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16563
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104886 | Essential Splice Site | 282 | 345 | 6 | 7 |
ENSDART00000145595 | Essential Splice Site | 91 | 160 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 29965965)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 28661062 GRCz11 22 28611183 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCTATCTATCTATCTATCTTTTTTGGTTAAATGTTGATTTCATTTCTGT[A/G]GCTCACGAAGAACTCCTTTAAAGAAGAAGATTTTGAGTAGTTTCTCTCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: