wu:fj78b06

Ensembl ID:
ENSDARG00000071065
ZFIN IDs:
ZDB-GENE-030131-9430, ZDB-GENE-030131-9430, ZDB-GENE-090312-45
Human Orthologue:
G6PD
Human Description:
glucose-6-phosphate dehydrogenase [Source:HGNC Symbol;Acc:4057]
Mouse Orthologues:
G6pd2, G6pdx
Mouse Descriptions:
glucose-6-phosphate dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:105977]
glucose-6-phosphate dehydrogenase X-linked Gene [Source:MGI Symbol;Acc:MGI:105979]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5035 Nonsense F2 line generated During 2018
sa24272 Nonsense Available for shipment Available now
sa19319 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11949 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5035
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104834 Nonsense 74 523 4 13
ENSDART00000138696 Nonsense 74 523 5 14

The following transcripts of ENSDARG00000071065 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 13973481)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14105414
GRCz11 23 13861491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCTTGTAGGTGGTTATTCAGAGATGGTCTYCTCCCTGAACAGACATA[T/A]TTTGTGGGTTTTGCTCGCTCAGATCTGACTGTGGATGCCATACGCATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104834 Nonsense 217 523 6 13
ENSDART00000138696 Nonsense 217 523 7 14

The following transcripts of ENSDARG00000071065 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 13969356)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14101289
GRCz11 23 13857366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGGAGCAAATCTACCGTATAGACCATTACCTGGGCAAAGAGATGGTG[C/T]AGAACCTGATGGTCCTCAGGTGTGCCACTCTTATTTCTCTCTCGCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104834 Essential Splice Site 494 523 12 13
ENSDART00000138696 Essential Splice Site 494 523 13 14
ENSDART00000104834 Essential Splice Site 494 523 12 13
ENSDART00000138696 Essential Splice Site 494 523 13 14

The following transcripts of ENSDARG00000071065 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 13959478)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14091411
GRCz11 23 13847488
KASP Assay ID:
554-6186.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGATAGAGTCTGAGAAAACACCACCCATCAAATACAAATACGGGAGG[T/C]AATATAAACCAGCTCACCATCGACAGACTTTTTCCAGGAAACGATGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104834 Essential Splice Site 494 523 12 13
ENSDART00000138696 Essential Splice Site 494 523 13 14
ENSDART00000104834 Essential Splice Site 494 523 12 13
ENSDART00000138696 Essential Splice Site 494 523 13 14

The following transcripts of ENSDARG00000071065 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 13959478)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 14091411
GRCz11 23 13847488
KASP Assay ID:
554-6186.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGATAGAGTCTGAGAAAACACCACCCATCAAATACAAATACGGGAGG[T/C]AATATAAACCAGCTCACCATCGACAGACTKTTTCCAGGAAAYKATGTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link