si:ch211-151i8.2

Ensembl ID:
ENSDARG00000071059
ZFIN ID:
ZDB-GENE-050208-373
Description:
GTP binding protein 2 [Source:RefSeq peptide;Acc:NP_001038661]
Human Orthologue:
GTPBP2
Human Description:
GTP binding protein 2 [Source:HGNC Symbol;Acc:4670]
Mouse Orthologue:
Gtpbp2
Mouse Description:
GTP binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1860138]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44989 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104828 Essential Splice Site 292 605 6 12
Genomic Location (Zv9):
Chromosome 22 (position 31422349)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 28916458
GRCz11 22 28865585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTGCCCGGACTTTGCAATGCTGGTGGTGGGAGCCAATACTGGCATTG[G/A]TTGGTATTTATGAATATGCATTTACAGTAGAGATCAAAATAAGAGTACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link