wisp3

Ensembl ID:
ENSDARG00000071048
ZFIN ID:
ZDB-GENE-041001-86
Description:
WNT1-inducible-signaling pathway protein 3 [Source:RefSeq peptide;Acc:NP_001159703]
Human Orthologue:
WISP3
Human Description:
WNT1 inducible signaling pathway protein 3 [Source:HGNC Symbol;Acc:12771]
Mouse Orthologue:
Wisp3
Mouse Description:
WNT1 inducible signaling pathway protein 3 Gene [Source:MGI Symbol;Acc:MGI:2685581]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32266 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104806 Nonsense 311 338 5 5
ENSDART00000131852 Nonsense 324 351 5 5
Genomic Location (Zv9):
Chromosome 20 (position 298113)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 288708
GRCz11 20 277343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAATGGTGAACGTCGAGTTCCACTGCAAAGGAGGATCCAATGTGCGCT[G/A]GAAGATGCAGTGGATCACGTCCTGCGTGTGTCAGAGGAAGTGCAGTAACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link