snx1

Ensembl ID:
ENSDARG00000071031
ZFIN ID:
ZDB-GENE-060302-3
Description:
sorting nexin 1 [Source:RefSeq peptide;Acc:NP_001122143]
Human Orthologue:
SNX1
Human Description:
sorting nexin 1 [Source:HGNC Symbol;Acc:11172]
Mouse Orthologue:
Snx1
Mouse Description:
sorting nexin 1 Gene [Source:MGI Symbol;Acc:MGI:1928395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11226 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075184 Nonsense 629 659 14 15
Genomic Location (Zv9):
Chromosome 25 (position 6297073)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 5890256
GRCz11 25 6017658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTGTTATGTCTTTCCTCACAGAAAGAGAAAGCTCGAGATTTTAAAAGA[C/T]AAATCATCAAGTATCTGGAGTCACTGCTGCACTCRCAACAACAGGTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link