zgc:171679

Ensembl ID:
ENSDARG00000071024
ZFIN ID:
ZDB-GENE-071004-95
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQG8]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43875 Nonsense Mutation detected in F1 DNA During 2018
sa31075 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104747 Nonsense 155 228 4 5
ENSDART00000112972 Nonsense 155 228 4 6
ENSDART00000139128 Nonsense 155 228 4 4
ENSDART00000104747 Nonsense 155 228 4 5
ENSDART00000112972 Nonsense 155 228 4 6
ENSDART00000139128 Nonsense 155 228 4 4
Genomic Location (Zv9):
Chromosome 22 (position 33201071)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30562201
GRCz11 22 30511396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTATTGGAGAGAAACTGATTGTCTGGCATGATAACATGGGGGTTTA[T/A]ATTCCTCTCCCAACAACTCCCTATAACAGAATTGGGGTGTTTCTAGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104747 Nonsense 155 228 4 5
ENSDART00000112972 Nonsense 155 228 4 6
ENSDART00000139128 Nonsense 155 228 4 4
ENSDART00000104747 Nonsense 155 228 4 5
ENSDART00000112972 Nonsense 155 228 4 6
ENSDART00000139128 Nonsense 155 228 4 4
Genomic Location (Zv9):
Chromosome 22 (position 33201071)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30562201
GRCz11 22 30511396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTATTGGAGAGAAACTGATTGTCTGGCATGATAACATGGGGGTTTA[T/A]ATTCCTCTCCCAACAACTCCCTATAACAGAATTGGGGTGTTTCTAGACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link