si:dkey-42l16.1

Ensembl ID:
ENSDARG00000071020
ZFIN ID:
ZDB-GENE-050208-442
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPV5]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25182 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104745 Nonsense 47 195 2 2
ENSDART00000138282 Nonsense 61 142 3 3
Genomic Location (Zv9):
Chromosome 22 (position 33366413)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30727543
GRCz11 22 30676738
KASP Assay ID:
554-7349.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTCTTGTTGGAGACACACAACCAAATATCAGAAATGTAGCAAGATCA[A/T]GAAATCTTCTTTTGCAGAAGATATTAAGACGTCATGTGTCTGTGATTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link