zgc:163126

Ensembl ID:
ENSDARG00000070985
ZFIN ID:
ZDB-GENE-070615-13
Description:
28S ribosomal protein S21, mitochondrial [Source:RefSeq peptide;Acc:NP_001153310]
Human Orthologue:
MRPS21
Human Description:
mitochondrial ribosomal protein S21 [Source:HGNC Symbol;Acc:14046]
Mouse Orthologues:
Gm5316, Mrps21
Mouse Descriptions:
mitochondrial ribosomal protein S21 Gene [Source:MGI Symbol;Acc:MGI:1913542]
predicted gene 5316 Gene [Source:MGI Symbol;Acc:MGI:3645576]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39231 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104657 Nonsense 60 87 2 2
Genomic Location (Zv9):
Chromosome 19 (position 9581419)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 9039958
GRCz11 19 8958883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTCGAGAAGCCCTGTCGCAAGCAAATCAGAAAGAACTATGAGAACTG[T/A]AAGCGAATCTACAACACCGAGATGTCCCGCAAGATTGGTTTCATAGCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link