
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tecra
- Ensembl ID:
- ENSDARG00000070956
- ZFIN ID:
- ZDB-GENE-090930-1
- Human Orthologue:
- TECR
- Human Description:
- trans-2,3-enoyl-CoA reductase [Source:HGNC Symbol;Acc:4551]
- Mouse Orthologue:
- Tecr
- Mouse Description:
- trans-2,3-enoyl-CoA reductase Gene [Source:MGI Symbol;Acc:MGI:1915408]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20137 | Nonsense | Available for shipment | Available now |
sa33305 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa40159 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa20138 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20137
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104614 | Nonsense | 10 | 346 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 50557715)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 45252135 GRCz11 3 49397546 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCGATACATTTGAGGAGCTATCATGGATGCTTTAGCTTTAGAAGCGAAA[G/T]GAGCCAAGGGTGAAGGTTCGGCGGCTCCTGCTCCTGCTGCTCCACCTCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33305
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104614 | Essential Splice Site | 61 | 346 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 50558609)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 45253029 GRCz11 3 49398440 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGTTTATGCTAGCATGTCTTAGCTATTTAGCATCTTAACATTTTTCTAC[A/T]GGTAGAGCCAACAGCCACGATTCTGGACATTAAGTCTATGTTCCACAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40159
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104614 | Essential Splice Site | 128 | 346 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 50572068)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 45266488 GRCz11 3 49411899 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCTTGAGCTCTTTCATATGTTGACTTCATCAGCCTGAATGTGTGTTTGC[A/T]GGTGTTCTTAATCGAGTGCATTGGACCACTTGTCCTGTACCTGCTGTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20138
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104614 | Nonsense | 176 | 346 | 6 | 11 |
- Genomic Location (Zv9):
- Chromosome 3 (position 50572452)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 45266872 GRCz11 3 49412283 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTCTGTCTGTTCTCCACAGTATAGCCTGTGCCTGTCACACCTTCCACTA[T/A]GCAAAGAGGATCATGGAGACATTGTTTGTCCATCGCTTCTCCCATGGCAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: