zgc:153948

Ensembl ID:
ENSDARG00000070951
ZFIN ID:
ZDB-GENE-061013-204
Description:
high mobility group AT-hook 1-like [Source:RefSeq peptide;Acc:NP_001070744]
Human Orthologue:
HMGA1
Human Description:
high mobility group AT-hook 1 [Source:HGNC Symbol;Acc:5010]
Mouse Orthologues:
Hmga1, Hmga1-rs1
Mouse Descriptions:
high mobility group AT-hook 1 Gene [Source:MGI Symbol;Acc:MGI:96160]
high mobility group AT-hook I, related sequence 1 Pseudogene [Source:MGI Symbol;Acc:MGI:96161]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7053 Nonsense Mutation detected in F1 DNA During 2018
sa12236 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104603 Nonsense 7 92 1 4
Genomic Location (Zv9):
Chromosome 6 (position 54098084)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54134818
GRCz11 6 54142926
KASP Assay ID:
554-5080.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATTCCACGTGTTTTGAACAGACTGCAATCATGAGTGATTCAGAAAAA[C/T]AAACCGTCTCCCTTAAGGACAAGGATGGAGTAGAGAAAAGAGGACGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104603 Nonsense 12 92 1 4
Genomic Location (Zv9):
Chromosome 6 (position 54098099)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54134833
GRCz11 6 54142941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAACAGACTGCAATCATGAGTGATTCAGAAAAAYAAACYGTCTCCCTT[A/T]AGGACAAGGATGGAGTAGAGAAAAGAGGACGAGGAAGACCAAGGAAGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: A large-scale genome-wide association study of Asian populations uncovers genetic factors influencing eight quantitative traits. (View Study)
  • Height: Genome-wide association study of height and body mass index in Australian twin families. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link