zgc:194119

Ensembl ID:
ENSDARG00000070940
ZFIN ID:
ZDB-GENE-081022-57
Description:
5-hydroxytryptamine receptor 2B [Source:RefSeq peptide;Acc:NP_001038208]
Human Orthologue:
HTR2B
Human Description:
5-hydroxytryptamine (serotonin) receptor 2B [Source:HGNC Symbol;Acc:5294]
Mouse Orthologue:
Htr2b
Mouse Description:
5-hydroxytryptamine (serotonin) receptor 2B Gene [Source:MGI Symbol;Acc:MGI:109323]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16649 Nonsense Available for shipment Available now
sa32414 Nonsense Available for shipment Available now
sa3157 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa16649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104569 Nonsense 233 443 3 3
Genomic Location (Zv9):
Chromosome 22 (position 40657209)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37737124
GRCz11 22 37672132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCGAGAGCTGCGAGGCCCTCCATTTCCACGGTCTTCCAGCAGGAACTCT[C/A]AGTTCTTGCTTCACCAGAGAAAATGGTCATATCGAATGGAATAAAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104569 Nonsense 344 443 3 3
Genomic Location (Zv9):
Chromosome 22 (position 40656875)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37736790
GRCz11 22 37671798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTTCAGTGGGTGGGCTATGTTTCGTCAGGCATCAACCCGCTGGTCTA[T/A]ACTCTGTTCAATAGGACGTTCAGACTGGCCTTCAGGCGCTACATCACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3157
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104569 Nonsense 438 443 3 3
Genomic Location (Zv9):
Chromosome 22 (position 40656595)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 37736510
GRCz11 22 37671518
KASP Assay ID:
554-2585.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGTTAGACACGTTGCTGTTGACAGACAATGAAGACTGCAAACCTGAT[G/T]AACACGTAAGCCACGTGTAGAAGATCTCATGAAAAGCCAAGAAAGAGATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link