zgc:175171

Ensembl ID:
ENSDARG00000070939
ZFIN IDs:
ZDB-GENE-030131-5064, ZDB-GENE-030131-5064
Description:
Zgc:175171 protein [Source:UniProtKB/TrEMBL;Acc:A9JRY5]
Human Orthologue:
ZNF740
Human Description:
zinc finger protein 740 [Source:HGNC Symbol;Acc:27465]
Mouse Orthologue:
Zfp740
Mouse Description:
zinc finger protein 740 Gene [Source:MGI Symbol;Acc:MGI:1915994]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41756 Nonsense Mutation detected in F1 DNA During 2018
sa11563 Essential Splice Site Available for shipment Available now
sa18580 Essential Splice Site Available for shipment Available now
sa27709 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104570   None 273 None 11
ENSDART00000109026 Nonsense 203 268 8 10
Genomic Location (Zv9):
Chromosome 11 (position 2255229)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2253639
GRCz11 11 2277061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATAAATCTTAAGTATATTCTGCTCTGGTCATTCAGGGGTGAAGCCGTA[T/A]GCTTGCTCCATGTGTGACAGGCGTTTTTTCCAACGTTACCACCTCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104570   None 273 None 11
ENSDART00000109026 Essential Splice Site 255 268 10 10
Genomic Location (Zv9):
Chromosome 11 (position 2254564)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2252974
GRCz11 11 2276396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATTGTCCTCAATTTAATTGCTCCCTTAAATTATTACTTTGTTTATTT[A/C]GAGATWAAGCCATTTGCTTGCACAATATGCCACWTTGACTNTTTTCCCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104570 Essential Splice Site 227 273 8 11
ENSDART00000109026   None 268 None 10
Genomic Location (Zv9):
Chromosome 11 (position 2241629)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2240039
GRCz11 11 2263461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGGTTTTTCCAACGTTACCACTTGGAAAGACACAGCCTCACTCACACTGG[T/C]ATGTGTCCTTTCACTGCACTCTGATTCTTGGATTGGGGCTGGAGTTTRTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104570 Nonsense 266 273 9 11
ENSDART00000109026   None 268 None 10
Genomic Location (Zv9):
Chromosome 11 (position 2236284)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 2234694
GRCz11 11 2258116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCGCGTTCACAGCGGAGAAAAGCCTTACCAGTGTGAGCGCTGCCAA[C/T]AGGTGAGAGCATGCTGGGTTTTCAGGATTATTAGGCTTTTTTCCACACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link