si:dkey-37m8.9

Ensembl ID:
ENSDARG00000070930
ZFIN ID:
ZDB-GENE-030131-8025
Description:
Novel protein similar to vertebrate cocaine and amphetamine regulated transcript (CART) [Source:UniP
Human Orthologue:
CARTPT
Human Description:
CART prepropeptide [Source:HGNC Symbol;Acc:24323]
Mouse Orthologue:
Cartpt
Mouse Description:
CART prepropeptide Gene [Source:MGI Symbol;Acc:MGI:1351330]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24218 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104535 Essential Splice Site 140 175 2 3
ENSDART00000131451 Essential Splice Site 75 110 2 3
Genomic Location (Zv9):
Chromosome 22 (position 39718412)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36895045
GRCz11 22 36835790
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAAACAGATTCCTGCTGTGGAGAAGAAGCTCGGCTGGGTTCCATCGG[T/G]GAGTCTATAGAGTTTATATCAGTGGTTACAGTTTTACACATATGTGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link