sox14

Ensembl ID:
ENSDARG00000070929
ZFIN ID:
ZDB-GENE-051113-268
Description:
Transcription factor Sox-14 [Source:UniProtKB/Swiss-Prot;Acc:Q32PP9]
Human Orthologue:
SOX14
Human Description:
SRY (sex determining region Y)-box 14 [Source:HGNC Symbol;Acc:11193]
Mouse Orthologue:
Sox14
Mouse Description:
SRY-box containing gene 14 Gene [Source:MGI Symbol;Acc:MGI:98362]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17546 Nonsense Available for shipment Available now
sa9664 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104532 Nonsense 37 238 1 1
Genomic Location (Zv9):
Chromosome 6 (position 26267643)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 26568854
GRCz11 6 26559415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCCAGAGAAGGAAAATGGCTCAAGAGAATCCCAAAATGCACAATTCC[G/T]AAATAAGCAAAAGACTCGGCGCCGAGTGGAAGCTGCTGTCTGAATCCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104532 Nonsense 55 238 1 1
Genomic Location (Zv9):
Chromosome 6 (position 26267589)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 26568800
GRCz11 6 26559361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGCAAAAGACTCGGCGCCGAGTGGAAGCTGCTGTCTGAATCCGAGAAG[C/T]GACCGTACATCGACGAGGCCAAGAGGCTGAGGGCTCAGCACATGAAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link