zgc:158268

Ensembl ID:
ENSDARG00000070907
ZFIN ID:
ZDB-GENE-061201-6
Description:
ligand-dependent corepressor [Source:RefSeq peptide;Acc:NP_001073441]
Human Orthologue:
LCOR
Human Description:
ligand dependent nuclear receptor corepressor [Source:HGNC Symbol;Acc:29503]
Mouse Orthologue:
Lcor
Mouse Description:
ligand dependent nuclear receptor corepressor Gene [Source:MGI Symbol;Acc:MGI:2443930]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15929 Nonsense Available for shipment Available now
sa24210 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104471 Nonsense 262 521 7 7
ENSDART00000110442 Nonsense 186 464 6 6
ENSDART00000143191 Nonsense 298 576 6 6
Genomic Location (Zv9):
Chromosome 22 (position 37649714)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34842092
GRCz11 22 34816974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTWGAGCCAGAAAMATCGCCTCCTTGGCCAACCAACACCTCTTTCTT[T/A]GGCTAGCCTAGAGTCTGTGGGTCTCCTCAACAGCCAAGCCCAGTCTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104471 Nonsense 478 521 7 7
ENSDART00000110442 Nonsense 402 464 6 6
ENSDART00000143191 Nonsense 514 576 6 6
Genomic Location (Zv9):
Chromosome 22 (position 37649066)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34842740
GRCz11 22 34817622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGCGTTTCGAAGGCGCAGAACATCTATGGGATCCCCCACAGCACCT[T/A]GGAGTACAAGGTGAAAGAGAGGATGGGCACACTGAAGAACCCGCCAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link