zgc:112966

Ensembl ID:
ENSDARG00000070899
ZFIN ID:
ZDB-GENE-050320-137
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQS7]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23492 Essential Splice Site Available for shipment Available now
sa23491 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060141   None 168 None 5
ENSDART00000137812 Essential Splice Site 17 127 None 6

The following transcripts of ENSDARG00000070899 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 18110307)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18955542
GRCz11 19 18418395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAATATAAAATAGATACTGCCTTCTTTTCTTTTAATGCTACTTGGTC[A/G]GGACCAAGGACAAGTCACTTTTCCAGGTAGGCACTGAATGATTGCATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060141   None 168 None 5
ENSDART00000137812 Essential Splice Site 26 127 3 6

The following transcripts of ENSDARG00000070899 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 18110160)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 18955395
GRCz11 19 18418248
KASP Assay ID:
2261-3145.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGCCTAAAGCTGAATGTAAGAAATGCTTCAAATCTATGCTACTACA[G/A]ATTCTTGCTCTGCACGTAAAGGAATGCAACACTGCTGAATATGAGACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link