zgc:162232

Ensembl ID:
ENSDARG00000070874
ZFIN ID:
ZDB-GENE-070410-45
Description:
acetylserotonin O-methyltransferase [Source:RefSeq peptide;Acc:NP_001103947]
Human Orthologue:
ASMT
Human Description:
acetylserotonin O-methyltransferase [Source:HGNC Symbol;Acc:750]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36427 Nonsense Mutation detected in F1 DNA During 2018
sa11754 Essential Splice Site Available for shipment Available now
sa485 Essential Splice Site Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa36427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086885 Nonsense 12 348 2 9
Genomic Location (Zv9):
Chromosome 17 (position 26657484)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26797403
GRCz11 17 26815794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACATTCTTCATCATGGCTGAGCATTTGTCCCAGAGTGAACTGGACTA[T/A]CCTTTCAAGCTTTTGGAATATTTCAATGGATTCAGGATCTCTAAGGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086885 Essential Splice Site 27 348 2 9
Genomic Location (Zv9):
Chromosome 17 (position 26657530)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26797449
GRCz11 17 26815840
KASP Assay ID:
2261-1128.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATCCTTTCAAGCTTTTGGAATATTTCAATGGATTCAGGATCTCTAAG[G/A]TTTGTGTTTCATGTTTTGTCTTTGTAAACACACATTGCTTTAATCGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa485
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086885 Essential Splice Site 86 348 3 9
Genomic Location (Zv9):
Chromosome 17 (position 26660188)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26800107
GRCz11 17 26818498
KASP Assay ID:
554-0336.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGGTTGCCATTGAGATTGTGGATGTGGAAGTGGTGCAGGGAAACGG[T/G]AAGCTGCTTAACAATCTCATCATTCCACCACAATTGGCTGGAAATAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link