ptpn23b

Ensembl ID:
ENSDARG00000070870
ZFIN ID:
ZDB-GENE-060503-179
Description:
protein tyrosine phosphatase-like [Source:RefSeq peptide;Acc:NP_001038393]
Human Orthologue:
PTPN23
Human Description:
protein tyrosine phosphatase, non-receptor type 23 [Source:HGNC Symbol;Acc:14406]
Mouse Orthologue:
Ptpn23
Mouse Description:
protein tyrosine phosphatase, non-receptor type 23 Gene [Source:MGI Symbol;Acc:MGI:2144837]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45667 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32240 Essential Splice Site Available for shipment Available now
sa43256 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16423 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45667
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104395 Essential Splice Site 96 1229 3 20
ENSDART00000122588   None 166 None 7
ENSDART00000127876 Essential Splice Site 96 1229 3 20
Genomic Location (Zv9):
Chromosome 19 (position 18826137)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19671372
GRCz11 19 19244325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGTGTTCCCATGGCAACTGGGCAGGAGGCTGCTCTGCCTGTGACATGG[T/C]AAAGATCATACTTGTTACAGTCAATGTGCATCATTTAAGTTTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104395 Essential Splice Site 300 1229 10 20
ENSDART00000122588   None 166 None 7
ENSDART00000127876 Essential Splice Site 300 1229 10 20
Genomic Location (Zv9):
Chromosome 19 (position 18828681)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19673916
GRCz11 19 19246869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCAGTTCTCTCTTGACAAACTTAATGAGGCAATTAAACAGAGCAAG[G/A]TAACTGTTCCTAATCATCCACACACACAGCCCAGCCATTTCAACTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104395 Essential Splice Site 658 1229 19 20
ENSDART00000122588   None 166 None 7
ENSDART00000127876 Essential Splice Site 658 1229 19 20
Genomic Location (Zv9):
Chromosome 19 (position 18847469)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19692704
GRCz11 19 19265657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTAACAGATTAGTTAATTTATTTATTAATCACCTTACTTTGTCCTGAA[G/A]ATGGAACACCACTGTGCAGGCTCTGATTGCCTCATTCGAGGCATATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104395 Nonsense 1066 1229 20 20
ENSDART00000122588   None 166 None 7
ENSDART00000127876 Nonsense 1066 1229 20 20
Genomic Location (Zv9):
Chromosome 19 (position 18851951)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 19697186
GRCz11 19 19270139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACCACAGCAAGTACATTCCAGATCTCAACTCTTTTCACAAGCACCCT[T/A]GAACCAAAATTCCCAAGTTCCATATGGTCCTCGTCAACTCGGTCAGCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link