
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-32e6.6
- Ensembl ID:
- ENSDARG00000070857
- ZFIN ID:
- ZDB-GENE-081031-90
- Description:
- Novel protein similar to vertebrate extracellular matrix protein 2, female organ and adipocyte speci
- Human Orthologue:
- U82695.9
- Human Description:
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JIN4]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24301 | Essential Splice Site | Available for shipment | Available now |
sa17226 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24301
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104383 | Essential Splice Site | 292 | 559 | 5 | 9 |
ENSDART00000143445 | Essential Splice Site | 292 | 523 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 23 (position 20380615)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 20165722 GRCz11 23 20092065 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGATAAACAACAATAAAATAACCCATCTGGCTTCACATGTCTTTAAAG[G/A]TTTGTCTTGTTTTCATGCCAGCTGCACAGAAATGCATTTATTCATTGCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17226
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104383 | Essential Splice Site | 345 | 559 | 6 | 9 |
ENSDART00000143445 | Essential Splice Site | 345 | 523 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome 23 (position 20380128)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 20165235 GRCz11 23 20091578 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAAAACAGATTCAGCTCCATTCCAGCAGGATTGCCCCCATCTATAGAGG[T/G]CAGTTCTGTAACCCAGTCAATGCTTCAGTCACTAGCTGCTCTTTATAGGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: