si:dkey-32e6.6

Ensembl ID:
ENSDARG00000070857
ZFIN ID:
ZDB-GENE-081031-90
Description:
Novel protein similar to vertebrate extracellular matrix protein 2, female organ and adipocyte speci
Human Orthologue:
U82695.9
Human Description:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JIN4]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24301 Essential Splice Site Available for shipment Available now
sa17226 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104383 Essential Splice Site 292 559 5 9
ENSDART00000143445 Essential Splice Site 292 523 5 9
Genomic Location (Zv9):
Chromosome 23 (position 20380615)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20165722
GRCz11 23 20092065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATAAACAACAATAAAATAACCCATCTGGCTTCACATGTCTTTAAAG[G/A]TTTGTCTTGTTTTCATGCCAGCTGCACAGAAATGCATTTATTCATTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104383 Essential Splice Site 345 559 6 9
ENSDART00000143445 Essential Splice Site 345 523 6 9
Genomic Location (Zv9):
Chromosome 23 (position 20380128)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20165235
GRCz11 23 20091578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAACAGATTCAGCTCCATTCCAGCAGGATTGCCCCCATCTATAGAGG[T/G]CAGTTCTGTAACCCAGTCAATGCTTCAGTCACTAGCTGCTCTTTATAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link