Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001038474.1
- Ensembl ID:
- ENSDARG00000070847
- Description:
- hypothetical protein LOC563088 [Source:RefSeq peptide;Acc:NP_001038474]
- Human Orthologue:
- TRIM35
- Human Description:
- tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
- Mouse Orthologue:
- Trim35
- Mouse Description:
- tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa39386 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39386
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000036273 | Nonsense | 408 | 453 | 6 | 6 |
| ENSDART00000086146 | Nonsense | 164 | 209 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 39787941)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 36964574 GRCz11 22 36905319 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTTTTCGTGTTGATCAGGATCTTGATCGAGTGCGAGTTGATCTGGATTA[T/A]GACAGAGGAACAGTGTCTTTCTCTGATCCTGTAAAGAACAAACATCTACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
