si:dkey-56d12.4

Ensembl ID:
ENSDARG00000070845
ZFIN ID:
ZDB-GENE-060531-147
Description:
hypothetical protein LOC799220 [Source:RefSeq peptide;Acc:NP_001103508]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19966 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104361 Nonsense 260 464 2 2
Genomic Location (Zv9):
Chromosome 3 (position 15047623)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15293229
GRCz10 5 50836139
GRCz11 3 15443029
GRCz11 5 51482732
GRCz11 KZ115972.1 7936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAATCCATCGTAAGCAAGGTGATTTCATGTTGGATTGACATCATGGAG[G/T]AGAACATGAGGGATTACGTACCATGGCTTCCCAAGGAAACGATCCAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link