evi5

Ensembl ID:
ENSDARG00000070839
ZFIN ID:
ZDB-GENE-041111-244
Description:
Evi5 protein [Source:UniProtKB/TrEMBL;Acc:A1L201]
Human Orthologue:
EVI5
Human Description:
ecotropic viral integration site 5 [Source:HGNC Symbol;Acc:3501]
Mouse Orthologue:
Evi5
Mouse Description:
ecotropic viral integration site 5 Gene [Source:MGI Symbol;Acc:MGI:104736]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45254 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104337 Splice Site None 359 None 9
ENSDART00000104339 Splice Site None 396 None 11
ENSDART00000111682 Essential Splice Site 15 816 2 20
ENSDART00000124947 Splice Site None 778 None 19

The following transcripts of ENSDARG00000070839 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 28776186)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29071829
GRCz11 6 29062390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTGTACAATTAGTTTTTCGTCAAATTAAATACTGTTTTTTTATTTCT[G/T]CCCAAAGGTGGCGACAGACAAGGTAACAGGTAAGCTGAGTTCGACTCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link