snrk

Ensembl ID:
ENSDARG00000070832
ZFIN ID:
ZDB-GENE-040718-84
Description:
SNF-related serine/threonine-protein kinase [Source:RefSeq peptide;Acc:NP_001180256]
Human Orthologue:
SNRK
Human Description:
SNF related kinase [Source:HGNC Symbol;Acc:30598]
Mouse Orthologues:
4921509C19Rik, AC109204.1, AC117197.1, AC151292.1, AC154483.1, AC161002.2, AC164312.1, AC170594.1, AC170594.2, AC171240.1, AC171682.4, AC186031.1, CT030692.1, Gm14147, Gm14151, Gm4567, Gm4922, Gm5890, Gm6176, Gm6882, Gm6902, Gm7168, Gm7736, Gm8603, Smok2a, Smok2b, Smok3a, Smok3b, Smok4a, Snrk
Mouse Descriptions:
predicted gene 14147 Gene [Source:MGI Symbol;Acc:MGI:3651555]
predicted gene 14151 Gene [Source:MGI Symbol;Acc:MGI:3651016]
predicted gene 4567 Gene [Source:MGI Symbol;Acc:MGI:3809658]
predicted gene 4922 Gene [Source:MGI Symbol;Acc:MGI:3644318]
predicted gene 5156 (Gm5156), mRNA [Source:RefSeq DNA;Acc:NM_001037248]
predicted gene 5890 Gene [Source:MGI Symbol;Acc:MGI:3649012]
predicted gene 6176 Gene [Source:MGI Symbol;Acc:MGI:3644439]
predicted gene 6882 Gene [Source:MGI Symbol;Acc:MGI:3645601]
predicted gene 6902 Gene [Source:MGI Symbol;Acc:MGI:3647238]
predicted gene 7168 Gene [Source:MGI Symbol;Acc:MGI:3643198]
predicted gene 7736 Gene [Source:MGI Symbol;Acc:MGI:3647086]
predicted gene 8603 Pseudogene [Source:MGI Symbol;Acc:MGI:3643185]
PredictedPutative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UTA8]
RIKEN cDNA 4921509C19 gene Gene [Source:MGI Symbol;Acc:MGI:2685851]
similar to serine/threonine kinase [Source:RefSeq peptide;Acc:NP_001030076]
similar to serine/threonine kinase [Source:RefSeq peptide;Acc:NP_001030076]
SNF related kinase Gene [Source:MGI Symbol;Acc:MGI:108104]
sperm motility kinase 2A Gene [Source:MGI Symbol;Acc:MGI:1351487]
sperm motility kinase 2B Gene [Source:MGI Symbol;Acc:MGI:3037705]
sperm motility kinase 3A Gene [Source:MGI Symbol;Acc:MGI:3693943]
sperm motility kinase 3B Gene [Source:MGI Symbol;Acc:MGI:3615348]
sperm motility kinase 4A Gene [Source:MGI Symbol;Acc:MGI:3036233]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17315 Essential Splice Site Available for shipment Available now
sa12100 Nonsense Available for shipment Available now
sa22752 Nonsense Available for shipment Available now
sa22751 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104323 Essential Splice Site None 804 None 6
ENSDART00000144594 Essential Splice Site None 243 None 3
Genomic Location (Zv9):
Chromosome 16 (position 9432916)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8218855
GRCz11 16 8132584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAACATTTGGGAATTTCAAGTGGTTTTAATGTTCGCCRGAGCGAGCGG[T/G]AAGTCAAAGCTTTGTGTGATAGTGCGTTAGAATGCTAACACGGTTAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104323 Nonsense 450 804 6 6
ENSDART00000144594   None 243 None 3
Genomic Location (Zv9):
Chromosome 16 (position 9352708)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8138647
GRCz11 16 8054799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCYTAAGCCWGGGGTCATGGCCCCACTTGCATCTGCTTCAGCCAAGCAA[C/T]GAACCTGCCTCTTTCGAGTGGAAGAAGATGAGGAGGAGGAAGAAGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104323 Nonsense 639 804 6 6
ENSDART00000144594   None 243 None 3
Genomic Location (Zv9):
Chromosome 16 (position 9352141)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8138080
GRCz11 16 8054232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTGGTAGTGCAGGAGGGGGAGGTGGAGGTGGTGGAAGTACAAAAGGA[C/T]AGGGAGGCCCTTCCAGCTGCTCCCGCAGCAGCAGCAACAACAACAACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104323 Nonsense 681 804 6 6
ENSDART00000144594   None 243 None 3
Genomic Location (Zv9):
Chromosome 16 (position 9352014)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8137953
GRCz11 16 8054105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAAGCGCAGGGGAACTAGTAGAGAGTCTAAAACTCATGAGTCTCTGCT[T/A]AAGTTCTCAGTTTCAGCATCGCAGCTCTGGAGGAGGTGGTGGCGGACGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link