zgc:136858

Ensembl ID:
ENSDARG00000070830
ZFIN ID:
ZDB-GENE-060421-6632
Description:
hypothetical protein LOC678543 [Source:RefSeq peptide;Acc:NP_001035392]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38063 Nonsense Mutation detected in F1 DNA During 2018
sa44292 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14428 Nonsense Available for shipment Available now
sa14329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104315 Nonsense 170 700 5 18
Genomic Location (Zv9):
Chromosome 25 (position 20537527)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19948316
GRCz11 25 20045970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATCCTCTCATAGCTCTGGATGTGAGTGCGGATCTCACAGAACTGGGT[C/T]GAACGCCTATCGCGGTTGTGTCTGCTGGAGTAAAATCCATTCTAGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104315 Essential Splice Site 373 700 11 18
Genomic Location (Zv9):
Chromosome 25 (position 20529759)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19940548
GRCz11 25 20038202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTAAGATACTATGTTTTTTGAATGACATTATTCATTGTTCAATATTCA[G/A]TTTGGTCAGACAAACCCAGGAAGTGTTTGCCAGTCATTTGGAGGAGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104315 Nonsense 578 700 16 18
ENSDART00000104315 Nonsense 578 700 16 18
Genomic Location (Zv9):
Chromosome 25 (position 20526926)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19937715
GRCz11 25 20035369
KASP Assay ID:
2261-9656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGTTGTGCACCGGCTCTCTCTCGCCCCCTGCYGGAGCATCTGCATTG[T/A]GTCKTGGTCACTTTGGGCTCACTGGGTGTGCTGGTGTGTGGAGAACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104315 Nonsense 578 700 16 18
ENSDART00000104315 Nonsense 578 700 16 18
Genomic Location (Zv9):
Chromosome 25 (position 20526926)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19937715
GRCz11 25 20035369
KASP Assay ID:
2261-9656.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGGTTGTGCACCGGCTCTCTCTCGCCCCCTGCYGGAGCATCTGCATTG[T/A]GTCKTGGTCACTTTGGGCTCACTGGGTGTGCTGGTGTGTGGAGAACATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link