zgc:112242

Ensembl ID:
ENSDARG00000070827
ZFIN IDs:
ZDB-GENE-050522-63, ZDB-GENE-050522-63
Description:
hypothetical protein LOC553694 [Source:RefSeq peptide;Acc:NP_001018504]
Human Orthologues:
TNNI1, TNNI2, TNNI3
Human Descriptions:
troponin I type 1 (skeletal, slow) [Source:HGNC Symbol;Acc:11945]
troponin I type 2 (skeletal, fast) [Source:HGNC Symbol;Acc:11946]
troponin I type 3 (cardiac) [Source:HGNC Symbol;Acc:11947]
Mouse Orthologues:
Tnni1, Tnni2, Tnni3
Mouse Descriptions:
troponin I, cardiac 3 Gene [Source:MGI Symbol;Acc:MGI:98783]
troponin I, skeletal, fast 2 Gene [Source:MGI Symbol;Acc:MGI:105070]
troponin I, skeletal, slow 1 Gene [Source:MGI Symbol;Acc:MGI:105073]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32529 Essential Splice Site Available for shipment Available now
sa1296 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa32529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073854 Essential Splice Site 94 181 5 7
ENSDART00000125845 Essential Splice Site 95 182 5 7
Genomic Location (Zv9):
Chromosome 25 (position 20608263)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20019052
GRCz11 25 20116706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGAGCGATATGATGTTCAATCTAAAGTTACCAAAAATGAAAAAGAGG[T/C]ACATGTTGATGATGTAGAAGCATTATTGAACGTATTTGTTACTTATTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1296
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073854 Nonsense 104 181 6 7
ENSDART00000125845 Nonsense 105 182 6 7
Genomic Location (Zv9):
Chromosome 25 (position 20608375)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20019164
GRCz11 25 20116818
KASP Assay ID:
554-1211.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTGTATTTTTAATACCATAGATTGTAGATTTAAACCATAAAATCTTC[G/T]AGCTGAAGGGTAAAATGAAGAGACCTGCCTTGAAGAGAGTGCGAGTGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link