
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000070813
- Ensembl ID:
- ENSDARG00000070813
- Human Orthologues:
- AL512662.2, MBL2, SFTPA1, SFTPA2, SFTPD
- Human Descriptions:
- mannose-binding lectin (protein C) 2, soluble (opsonic defect) [Source:HGNC Symbol;Acc:6922]
- surfactant protein A1 [Source:HGNC Symbol;Acc:10798]
- surfactant protein A2 [Source:HGNC Symbol;Acc:10799]
- surfactant protein D [Source:HGNC Symbol;Acc:10803]
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B5MCL0]
- Mouse Orthologues:
- Mbl1, Mbl2, Sftpa1, Sftpd
- Mouse Descriptions:
- mannose-binding lectin (protein A) 1 Gene [Source:MGI Symbol;Acc:MGI:96923]
- mannose-binding lectin (protein C) 2 Gene [Source:MGI Symbol;Acc:MGI:96924]
- surfactant associated protein A1 Gene [Source:MGI Symbol;Acc:MGI:109518]
- surfactant associated protein D Gene [Source:MGI Symbol;Acc:MGI:109515]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15570 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15570
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000075931 | Nonsense | 166 | 204 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 6 (position 29531408)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 29827051 GRCz11 6 29817612 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCGATGGGTGACATTAGTTTTGCAAAGAACTCTTTTAGAAAACATTGCAT[T/A]ACTGAAACWATTASTATCCWGTGATTTTAATAAGAAGCCATTTATTAAAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Age-related macular degeneration: Insights into the genetic architecture of early stage age-related macular degeneration: a genome-wide association study meta-analysis. (View Study)
- Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
- Chronic obstructive pulmonary disease-related biomarkers: Genome-wide association analysis of blood biomarkers in chronic obstructive pulmonary disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: