znf516

Ensembl ID:
ENSDARG00000070809
ZFIN ID:
ZDB-GENE-060503-194
Description:
zinc finger protein 516 [Source:RefSeq peptide;Acc:NP_001153141]
Human Orthologue:
ZNF516
Human Description:
zinc finger protein 516 [Source:HGNC Symbol;Acc:28990]
Mouse Orthologue:
Zfp516
Mouse Description:
zinc finger protein 516 Gene [Source:MGI Symbol;Acc:MGI:2443957]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43267 Nonsense Mutation detected in F1 DNA During 2018
sa12406 Essential Splice Site Available for shipment Available now
sa45669 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15699 Nonsense Available for shipment Available now
sa39243 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076716 Nonsense 426 1045 1 10
ENSDART00000104279 Nonsense 428 1084 2 5
Genomic Location (Zv9):
Chromosome 19 (position 22197609)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22130989
GRCz11 19 21715312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGGGCTGGGAAGAAAGGTTAGCTGATGCGGATGTAGCATACGACAGG[G/T]AAAAAGGCGAGTATGTCTTACTCAGACAGGACAAGCGGAAGAAATCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076716 Essential Splice Site 456 1045 None 10
ENSDART00000104279   479 1084 2 5
Genomic Location (Zv9):
Chromosome 19 (position 22197454)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22130834
GRCz11 19 21715157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACTCCAGATCAGCACAGCAATGGAGAAAAGAACAGCCATGTTTCAAC[A/T]GGTGAGCGAAGCCCTGAAAATCTGAGTGACTCTGAGTATCGCCCTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076716 Essential Splice Site 682 1045 7 10
ENSDART00000104279   662 1084 3 5
Genomic Location (Zv9):
Chromosome 19 (position 22194386)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22127766
GRCz11 19 21712089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACCTCAACTCACCTGGAGAGGGCAGCACTGAGTGACGCCGCTTTAAA[G/A]ACAGAGGAAGAAAAGAGCAAGGGTTTGGAGGAAAGCAGCTCCACAGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15699
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076716 Nonsense 848 1045 7 10
ENSDART00000104279 Nonsense 829 1084 3 5
Genomic Location (Zv9):
Chromosome 19 (position 22193887)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22127267
GRCz11 19 21711590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGCACACAGCCRCAGCGCCAGGGGCAKCATCGCACTCGTCCAAACAC[A/T]AAACCAGCAAGTCCAGGACAGATGAGTTGGCAGGYAGTAAACAYAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076716 Nonsense 933 1045 7 10
ENSDART00000104279 Nonsense 914 1084 3 5
Genomic Location (Zv9):
Chromosome 19 (position 22193632)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22127012
GRCz11 19 21711335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAAAGCTCACGCTCCTCAGACCCCCAGTAAGTCTGATTCTCAAGCT[C/T]AGGATACACCGTCTGTGGCTGGGTACGACCCCTGGAACAGACTGGGCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link