zgc:172194

Ensembl ID:
ENSDARG00000070804
ZFIN ID:
ZDB-GENE-080220-26
Description:
nadrin [Source:RefSeq peptide;Acc:NP_001108378]
Human Orthologue:
ARHGAP17
Human Description:
Rho GTPase activating protein 17 [Source:HGNC Symbol;Acc:18239]
Mouse Orthologue:
Arhgap17
Mouse Description:
Rho GTPase activating protein 17 Gene [Source:MGI Symbol;Acc:MGI:1917747]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33129 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109003 Nonsense 127 797 5 22
ENSDART00000134014 Nonsense 77 536 4 16
Genomic Location (Zv9):
Chromosome 3 (position 18342203)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18465241
GRCz11 3 18614981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCGCTTCTTCTCCTTTTAGAAAAAGCTTCCTCTGATGATCCTTTCA[C/T]AATCCATGGTGGAAGGAGTAGCTCAGCTTGGAGAGGAGTCCCTTATAGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link