zgc:109744

Ensembl ID:
ENSDARG00000070800
ZFIN ID:
ZDB-GENE-050809-146
Description:
Zgc:109744 [Source:UniProtKB/TrEMBL;Acc:Q499C4]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4808 Nonsense F2 line generated During 2018
sa12200 Nonsense Available for shipment Available now
sa18084 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4808
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080260 Nonsense 99 768 3 4
Genomic Location (Zv9):
Chromosome 19 (position 22828807)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22760187
GRCz11 19 22344510
KASP Assay ID:
554-3509.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGTCTGCTGATTTCCGAAGCTTAATTGAGAGAAACACGACTACAGCTT[T/A]GAGCCTTACTGGAGATGCTAGAGAGAACTTTTTTGAGTCCGATGTCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080260 Nonsense 526 768 3 4
Genomic Location (Zv9):
Chromosome 19 (position 22827527)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22758907
GRCz11 19 22343230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGGACTCATTCATCATCATGAAGAAGTTGCTTTATTTGTATCYGACCTG[C/T]AGCTTCTRAATRACAACTCAAGCATCCTGTTGGACAGCATCAATGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080260 Nonsense 639 768 3 4
Genomic Location (Zv9):
Chromosome 19 (position 22827187)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22758567
GRCz11 19 22342890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATTCAGATTTTGCAGAGACAATGCTGACAACCAGTATGGTACTCTCT[T/A]KAAGACTTGTTTACAGAAGATGATGAAAGCCCTTGCAGCAGTAATGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link