zgc:110788

Ensembl ID:
ENSDARG00000070746
ZFIN ID:
ZDB-GENE-050227-13
Description:
hypothetical protein LOC503601 [Source:RefSeq peptide;Acc:NP_001013306]
Human Orthologue:
SFT2D2
Human Description:
SFT2 domain containing 2 [Source:HGNC Symbol;Acc:25140]
Mouse Orthologue:
Sft2d2
Mouse Description:
SFT2 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917362]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13673 Essential Splice Site Available for shipment Available now
sa40735 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104160 Essential Splice Site 81 166 3 8
Genomic Location (Zv9):
Chromosome 6 (position 36789928)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36863518
GRCz11 6 36841412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTTTGTTGTGTTTTATACATTGGGAAACGTTTGCTCCTTAGCAAGG[T/A]GAGTCATCWGGTTTATARCAACTAAAATTCTGTGACTATTTGCATTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104160 Essential Splice Site 150 166 8 8
Genomic Location (Zv9):
Chromosome 6 (position 36792076)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 36865666
GRCz11 6 36843560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAACCAAGTACAGTATTTTTAATTCTCTATGCTGTCTTTGTCTTAACC[A/G]GGGATGCTGTACTGAAGTTTTTCTCCATGTTGTGCAACATGTGTATGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link