vdrb

Ensembl ID:
ENSDARG00000070721
ZFIN ID:
ZDB-GENE-080403-10
Description:
Vitamin D3 receptor B [Source:UniProtKB/Swiss-Prot;Acc:Q1L673]
Human Orthologue:
VDR
Human Description:
vitamin D (1,25- dihydroxyvitamin D3) receptor [Source:HGNC Symbol;Acc:12679]
Mouse Orthologue:
Vdr
Mouse Description:
vitamin D receptor Gene [Source:MGI Symbol;Acc:MGI:103076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20759 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104116 Nonsense 380 422 8 8
Genomic Location (Zv9):
Chromosome 6 (position 38886057)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38957657
GRCz11 6 38955193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCCGTGCACATCACCCGGGGGGGCGTCTGCTTTACGCTAAGATGATC[C/T]AGAAGCTGGCGGATCTCCGCAGCCTGAACGAAGAGCACTCCAAACAGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link