zgc:173544

Ensembl ID:
ENSDARG00000070714
ZFIN ID:
ZDB-GENE-030131-6229
Description:
hypothetical protein LOC793869 [Source:RefSeq peptide;Acc:NP_001107102]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21872 Nonsense Available for shipment Available now
sa7290 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104107 Nonsense 377 697 3 3
Genomic Location (Zv9):
Chromosome 11 (position 16404803)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15885503
GRCz11 11 16020138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAACCAGCCCACATCAGCTACCAGTCTGTAGCCCAACCGATTGTTCAA[C/T]AAGCCAGCTATGAATCTGTGTCTCTTTCCAATGGAGCAAAACTTGTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7290
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104107 Nonsense 579 697 3 3
Genomic Location (Zv9):
Chromosome 11 (position 16404197)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 15884897
GRCz11 11 16019532
KASP Assay ID:
554-4452.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCYCTYGSTGAAYACCWGAWATCTCCTGTTCCAGGGCAGTTTGTTTCC[C/T]AGCCTCAAATGCTTCCTAGTAGTMAGTCTCTCRCTSAGTCAAGCTCTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link