zgc:162180

Ensembl ID:
ENSDARG00000070713
ZFIN ID:
ZDB-GENE-070424-25
Description:
hypothetical protein LOC799770 [Source:RefSeq peptide;Acc:NP_001082915]
Human Orthologues:
PRSS21, PRSS38, PRSS42, PRSS44, PRSS45, PRSS50
Human Descriptions:
protease, serine, 21 (testisin) [Source:HGNC Symbol;Acc:9485]
protease, serine, 38 [Source:HGNC Symbol;Acc:29625]
protease, serine, 42 [Source:HGNC Symbol;Acc:30716]
protease, serine, 44 [Source:HGNC Symbol;Acc:37324]
protease, serine, 45 [Source:HGNC Symbol;Acc:30717]
protease, serine, 50 [Source:HGNC Symbol;Acc:17910]
Mouse Orthologues:
Prss21, Prss38, Prss41, Prss42, Prss43, Prss44, Prss45, Prss46, Prss50
Mouse Descriptions:
protease, serine, 21 Gene [Source:MGI Symbol;Acc:MGI:1916698]
protease, serine, 38 Gene [Source:MGI Symbol;Acc:MGI:2685095]
protease, serine, 41 Gene [Source:MGI Symbol;Acc:MGI:1918253]
protease, serine, 42 Gene [Source:MGI Symbol;Acc:MGI:2665280]
protease, serine, 43 Gene [Source:MGI Symbol;Acc:MGI:2684822]
protease, serine, 44 Gene [Source:MGI Symbol;Acc:MGI:1920586]
protease, serine, 45 Gene [Source:MGI Symbol;Acc:MGI:3605764]
protease, serine, 46 Gene [Source:MGI Symbol;Acc:MGI:1921556]
protease, serine, 50 Gene [Source:MGI Symbol;Acc:MGI:2447303]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40743 Nonsense Mutation detected in F1 DNA During 2018
sa26787 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004240 Nonsense 9 387 1 8
Genomic Location (Zv9):
Chromosome 6 (position 39016895)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39088495
GRCz11 6 39086031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGAGAAGAGATAGCTGGTGAAGATGTGGAGGTTCACTTGTGTCAGTT[T/A]AGCGCTGCTCTTGTGTGTTCAAGGTAAGGGACTCTATTTGATGTTTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004240 Essential Splice Site 383 387 8 8
Genomic Location (Zv9):
Chromosome 6 (position 39021804)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39093404
GRCz11 6 39090940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTAGAAAATACAAGACGTCCTTCATCTGTTTGTTTTTGTGTCTCTGC[A/G]GTGGATCAAAGAGGGTAAACTCTTGGTCAACACAAGCTTCTCTGTGACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link