wu:fi42e03

Ensembl ID:
ENSDARG00000070709
ZFIN ID:
ZDB-GENE-030131-6284
Description:
Wu:fi42e03 protein [Source:UniProtKB/TrEMBL;Acc:A8WG69]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12535 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103388 Nonsense 89 333 1 1
Genomic Location (Zv9):
Chromosome 11 (position 30416136)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29292122
GRCz11 11 29539296
KASP Assay ID:
2260-4412.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTATCAGCCAGCAAGCAGGACACTCCACCCATGAGTATKTTGTTGAG[C/T]AGAGTGGACAATCGCATTTCAAGCCGGTGCATTCCCATAGGGTTCACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link