im:6903726

Ensembl ID:
ENSDARG00000070673
ZFIN ID:
ZDB-GENE-050506-71
Description:
Im:6903726 protein [Source:UniProtKB/TrEMBL;Acc:Q6DEI9]
Human Orthologue:
PTGR2
Human Description:
prostaglandin reductase 2 [Source:HGNC Symbol;Acc:20149]
Mouse Orthologue:
Ptgr2
Mouse Description:
prostaglandin reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1916372]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12521 Nonsense Available for shipment Available now
sa12562 Nonsense Available for shipment Available now
sa45616 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103985 Nonsense 45 384 2 10
ENSDART00000103985 Nonsense 45 384 2 10
Genomic Location (Zv9):
Chromosome 17 (position 37466776)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37351673
GRCz11 17 37299258
KASP Assay ID:
2261-1366.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGCGTTAATAAAAAAGAGAAAATGTTAAATGTAACAAGAGTTGTGT[T/A]RAGCTCCCGAYCAGGTAAATGTTAAAGGTTTTGWTCAGCTTACACWACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103985 Nonsense 45 384 2 10
ENSDART00000103985 Nonsense 45 384 2 10
Genomic Location (Zv9):
Chromosome 17 (position 37466776)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37351673
GRCz11 17 37299258
KASP Assay ID:
2261-1366.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGCGTTAATAAAAAAGAGAAAATGTTAAATGTAACAAGAGTTGTGT[T/A]RAGCTCCCGAYCAGGTAAATGTTAAAGGTTTTGWTCAGCTTACACWACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103985 Nonsense 82 384 3 10
Genomic Location (Zv9):
Chromosome 17 (position 37466562)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37351459
GRCz11 17 37299044
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACATCATCAGAGCTGAAGGAAGGACAAGTGTTGGTTCGGACTCTTTA[T/A]CTCTCAGTTGACCCTTACATGGTGAGACGTGACTCGCTCCATCTGCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link