slc2a9l1

Ensembl ID:
ENSDARG00000070672
ZFIN ID:
ZDB-GENE-090915-3
Description:
solute carrier family 2 (facilitated glucose transporter), member 9-like 1 [Source:RefSeq peptide;A

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6203 Nonsense Mutation detected in F1 DNA During 2018
sa17250 Nonsense Available for shipment Available now
sa41814 Nonsense Mutation detected in F1 DNA During 2018
sa17113 Nonsense Available for shipment Available now
sa6202 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103983 Nonsense 157 493 5 12
Genomic Location (Zv9):
Chromosome 11 (position 19918672)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19335986
GRCz11 11 19498328
KASP Assay ID:
554-4655.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTAAATGTCCATTCCATCTACCTCGGCGAGAGCTCACCAAAAAAGATC[A/T]GAGGTGTGGTGTTRCTCACAAGCGCTATATTTTTGGCCCTTGGCAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103983 Nonsense 230 493 6 12
Genomic Location (Zv9):
Chromosome 11 (position 19916000)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19333314
GRCz11 11 19495656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCCCCTCGATATATTCTGATTGAAAAAAWCAACACTGAACAGTGTAGA[A/T]AAGGTATGTTATGTTCACCCAAATCARTTTAWCCATCTGGTCAATGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103983 Nonsense 342 493 9 12
Genomic Location (Zv9):
Chromosome 11 (position 19913967)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19331281
GRCz11 11 19493623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGCGCATTTGTAGGGCCTGTTCATTGAGAGAGTGGGGAGAAAACCGT[T/A]GATGTGGAGAGGGTTTGGGGGCATGTCAGTCGTCATGGCATTAATCATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103983 Nonsense 345 493 9 12
Genomic Location (Zv9):
Chromosome 11 (position 19913959)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19331273
GRCz11 11 19493615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTRTAGGGCCTGTTCATTGAGARAGTGGGGAGAAAACCGTTGATGTGG[A/T]GAGGGTTTGGGGGCATGTCAGTCGTCATGGCATTRATCATARTCACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103983 Nonsense 412 493 11 12
Genomic Location (Zv9):
Chromosome 11 (position 19912655)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 19329969
GRCz11 11 19492311
KASP Assay ID:
554-4024.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGCAATGAGATGTTYATCCAATCAYACCGTCCAGCTGCATTTGTGTA[T/A]ATCGGTATCCTGCGCTGGGTAGGATTCRCCCTTCTTGGATTCGTCTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link