si:dkey-269d20.3

Ensembl ID:
ENSDARG00000070669
ZFIN ID:
ZDB-GENE-100922-34
Description:
similar to chemokine (C-X-C motif) receptor 3.1 [Source:RefSeq peptide;Acc:NP_001138285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16846 Nonsense Available for shipment Available now
sa10872 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103981 Nonsense 150 380 3 3
ENSDART00000146611 Nonsense 144 374 2 2
Genomic Location (Zv9):
Chromosome 16 (position 13587379)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11946470
GRCz11 16 11837372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKTCATCAGTGTGGACTGCTACCTGTCCATYRTTCATGGAGTTCAGAAGT[T/A]ATCTCGTAAAAAGCCCATGRTGGTTCATGGATGTTGTCTGATTATCTGSC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103981 Nonsense 283 380 3 3
ENSDART00000146611 Nonsense 277 374 2 2
Genomic Location (Zv9):
Chromosome 16 (position 13587778)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11946869
GRCz11 16 11837771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGCCTTCATYGTGAACACMGGTGCTCGTCCAGTGCACATTGATCCTT[T/G]AACAGGAGAGAGTGAATGTGAATGGAGGCAGTGGACAGCTASCAAAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link