zgc:136903

Ensembl ID:
ENSDARG00000070666
ZFIN ID:
ZDB-GENE-070424-6
Description:
hypothetical protein LOC562845 [Source:RefSeq peptide;Acc:NP_001103501]
Human Orthologue:
RHO
Human Description:
rhodopsin [Source:HGNC Symbol;Acc:10012]
Mouse Orthologue:
Rho
Mouse Description:
rhodopsin Gene [Source:MGI Symbol;Acc:MGI:97914]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21885 Nonsense Available for shipment Available now
sa45425 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103973 Nonsense 213 355 1 1
Genomic Location (Zv9):
Chromosome 11 (position 19517434)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18934748
GRCz11 11 19097090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGACTGAGAACGAGTCGTTTGTCATCTATATGTTCGTGGTTCATTTCT[C/A]AATCCCTCTCACCATCATTTCTTTCTGCTATGGGCGCCTGCTTTGCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103973 Nonsense 265 355 1 1
Genomic Location (Zv9):
Chromosome 11 (position 19517277)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18934591
GRCz11 11 19096933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTGACCCGAATGGTGATCCTCATGGTCATCGCATTTTTAATATGTTG[G/A]CTCCCCTATGCCAGCGTGGCCTGGTACATCTTCACCCACCAGGGGAGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link