vhl

Ensembl ID:
ENSDARG00000070617
ZFIN ID:
ZDB-GENE-070112-1042
Description:
von Hippel-Lindau disease tumor suppressor [Source:RefSeq peptide;Acc:NP_001074153]
Human Orthologue:
VHL
Human Description:
von Hippel-Lindau tumor suppressor [Source:HGNC Symbol;Acc:12687]
Mouse Orthologue:
Vhl
Mouse Description:
von Hippel-Lindau tumor suppressor Gene [Source:MGI Symbol;Acc:MGI:103223]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2117 Nonsense Confirmed mutation in F2 line Unknown
sa40757 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
hu2117
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103878 Nonsense 23 175 1 3
Genomic Location (Zv9):
Chromosome 6 (position 40385613)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40457213
GRCz11 6 40454749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGGGCAGCAGCCGCTCCCGCTGGTCCGGTCTCTGATCAGCCGGATA[C/T]AGGTCAACGTTCTGTTCTGTAACTGCAGCCCGCGCGTCGTCAAGCCCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40757
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103878 Essential Splice Site 106 175 2 3
Genomic Location (Zv9):
Chromosome 6 (position 40383851)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40455451
GRCz11 6 40452987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATCTCTTGAAAATGGGCAAGTCGCAAATGCCAAGATCACATTGCCTG[G/T]TATGCATATTTCACTTCATATTTCAATCACACATCTTGTACTAATATTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link