zgc:152986

Ensembl ID:
ENSDARG00000070611
ZFIN ID:
ZDB-GENE-061013-762
Description:
hypothetical protein LOC768168 [Source:RefSeq peptide;Acc:NP_001070779]
Mouse Orthologue:
4930503B20Rik
Mouse Description:
RIKEN cDNA 4930503B20 gene Gene [Source:MGI Symbol;Acc:MGI:1922264]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40759 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103868 Nonsense 81 176 3 3
Genomic Location (Zv9):
Chromosome 6 (position 40400962)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40472562
GRCz11 6 40470098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTTATAGCCTATGAGGTACTTTCTGACAGAGAGAAGAGACGAGTTTA[T/A]GATCAAATGGACCATCTCTCAAACCCTGATCAGGGCAGTGAGAGAATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link