
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
A3KP94_DANRE
- Ensembl ID:
- ENSDARG00000070605
- Description:
- LOC557782 protein [Source:UniProtKB/TrEMBL;Acc:A3KP94]
- Human Orthologue:
- B4GALNT2
- Human Description:
- beta-1,4-N-acetyl-galactosaminyl transferase 2 [Source:HGNC Symbol;Acc:24136]
- Mouse Orthologue:
- B4galnt2
- Mouse Description:
- beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI Symbol;Acc:MGI:1342058]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12224 | Nonsense | Available for shipment | Available now |
sa12308 | Nonsense | Available for shipment | Available now |
sa26051 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33156 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa12224
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103858 | Nonsense | 210 | 491 | 7 | 12 |
ENSDART00000103858 | Nonsense | 210 | 491 | 7 | 12 |
- Genomic Location (Zv9):
- Chromosome 3 (position 23342063)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 22920274 GRCz11 3 23050822 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACACAACTYAATGATCTGYTGTCCARAGTGAGCTACACCAGCACCGTCTA[C/A]CACATCARAACATCAGACCTGGGTGAGAACAGCAGACATGCTYACTTWAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12308
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103858 | Nonsense | 210 | 491 | 7 | 12 |
ENSDART00000103858 | Nonsense | 210 | 491 | 7 | 12 |
- Genomic Location (Zv9):
- Chromosome 3 (position 23342063)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 22920274 GRCz11 3 23050822 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACACAACTYAATGATCTGYTGTCCARAGTGAGCTACACCAGCACCGTCTA[C/A]CACATCARAACATCAGACCTGGGTGAGAACAGCAGACATGCTYACTTWAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26051
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103858 | Nonsense | 269 | 491 | 9 | 12 |
- Genomic Location (Zv9):
- Chromosome 3 (position 23345070)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 22923281 GRCz11 3 23053829 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCATAATAACCAAGACTTTTCTGAGGTATGAGGAGCTGAATATCCTTT[T/G]AAACAGTATCAGGAAGTTTTATCCAAAAATCAAGATCCTTATTGCTGACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33156
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000103858 | Nonsense | 366 | 491 | 11 | 12 |
- Genomic Location (Zv9):
- Chromosome 3 (position 23346497)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 22924708 GRCz11 3 23055256 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTTTTTTTCTGTTTAGCTTGGTGGCAGCGTGATTGGTGATCCGCCTTA[T/A]TTCATTCTTGAATATGACGAGGGAGATGAGGAAGAAGGCGGCTGCCTGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: