zgc:162509

Ensembl ID:
ENSDARG00000070604
ZFIN ID:
ZDB-GENE-050809-100
Description:
hypothetical protein LOC553299 [Source:RefSeq peptide;Acc:NP_001077285]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39084 Nonsense Mutation detected in F1 DNA During 2018
sa9620 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059926   None 581 3 3
ENSDART00000103857 Nonsense 598 692 2 2
Genomic Location (Zv9):
Chromosome 16 (position 15741330)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14086222
GRCz11 16 13976342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGATCTCTGCAACATACACTGATGTTTCCAGCAGGTACCTGATGGAT[A/T]GAGTCAGCTCACTGGGTAAACTGATGGCCATGGATAAAAATAAGCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059926   None 581 3 3
ENSDART00000103857 Nonsense 621 692 2 2
Genomic Location (Zv9):
Chromosome 16 (position 15741399)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14086291
GRCz11 16 13976411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGATGGCCATGGATAAAAATAAGCCAGAATTTGAGCATGAGCGACAA[C/T]AGCTMCAGAACGCCTGTGATGAGGCWGAGAAARGCATYTTAAGGCTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link