zgc:153612

Ensembl ID:
ENSDARG00000070603
ZFIN ID:
ZDB-GENE-060825-99
Description:
hypothetical protein LOC751725 [Source:RefSeq peptide;Acc:NP_001038900]
Human Orthologue:
HSPA12A
Human Description:
heat shock 70kDa protein 12A [Source:HGNC Symbol;Acc:19022]
Mouse Orthologue:
Hspa12a
Mouse Description:
heat shock protein 12A Gene [Source:MGI Symbol;Acc:MGI:1920692]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45600 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123198 Essential Splice Site 206 658 5 11
Genomic Location (Zv9):
Chromosome 17 (position 21059019)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21229692
GRCz11 17 21249528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGGAAGATGCCAGCCAAGCAGTTTATGAGAGAAGCAGCCTACAAGG[T/C]ATAATCCTTCATAGCCACATATGCAGATAAAAAGCACGTCTCACTTTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Genome-wide association analyses in East Asians identify new susceptibility loci for colorectal cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link