zgc:172180

Ensembl ID:
ENSDARG00000070600
ZFIN ID:
ZDB-GENE-080219-31
Description:
hypothetical protein LOC100141364 [Source:RefSeq peptide;Acc:NP_001108400]
Human Orthologue:
DYRK3
Human Description:
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 [Source:HGNC Symbol;Acc:3094]
Mouse Orthologue:
Dyrk3
Mouse Description:
dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:133

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41818 Nonsense Mutation detected in F1 DNA During 2018
sa35070 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41818
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128681 Nonsense 25 582 2 3
Genomic Location (Zv9):
Chromosome 11 (position 22098525)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21104756
GRCz11 11 21265324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTCTTTTTCCACAGCTCGCCACGGGGATGGTCTGTATGACTCCTA[C/A]ATGCGCACTGATCACATAGTGAACCAGGACGCTGATGTGAATGGACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128681 Nonsense 515 582 3 3
Genomic Location (Zv9):
Chromosome 11 (position 22095163)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21101394
GRCz11 11 21261962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTAGTACTCGTATGACACCAGTTCAGGCTTTAAGACATCCATGGCTCTA[C/A]AAGAGACTGCCCAAGCCTGCACCTGGTGGTGAGAAGACTGTGCTACCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link