zgc:153973

Ensembl ID:
ENSDARG00000070598
ZFIN ID:
ZDB-GENE-061013-677
Description:
Enolase-like protein ENO4 [Source:UniProtKB/Swiss-Prot;Acc:Q08BC6]
Human Orthologue:
ENO4
Human Description:
enolase family member 4 [Source:HGNC Symbol;Acc:31670]
Mouse Orthologue:
Eno4
Mouse Description:
enolase 4 Gene [Source:MGI Symbol;Acc:MGI:2441717]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13651 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103845 Nonsense 48 576 1 13
Genomic Location (Zv9):
Chromosome 17 (position 21125383)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21275532
GRCz11 17 21295368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAACGGGGTCCCGCAAAAGATAGAAAGCGTCCTGAACGAGATGTTTT[G/A]GCAGAAGCCRGATGATATCTATGGTTATCTGGTGGGACAAATCACTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link